Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Genome Wide, Gene Expression, Quantitative RT-PCR, Isolation, Control, Western Blot, Microarray, Expressing

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Expression of RAB23 and CNOT6 is regulated by PCIF1 at both the mRNA and protein levels. ( A – C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3), using the specific primer set detecting PCIF1 ( A ), RAB23 ( B ), and CNOT6 ( C ) expression. ( D , E ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) with the indicated antibodies. Signal intensities obtained from immunoblotting were quantified using ImageJ software version 1.52. The y-axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Control, Western Blot, Software, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant PCIF1 restores the normal levels of target mRNA expression. ( A , B ) RT-qPCR analysis of total RNAs isolated from HeLa cells transfected with a control empty vector (Vec) or a vector expressing siRNA-resistant PCIF1 (PCIF1siR) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1 #3), using the specific primer set detecting RAB23 ( A ) and CNOT6 ( B ) expression. The y -axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between indicated pairs (Student’s t -test, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Transfection, Control, Plasmid Preparation, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 does not regulate expression of its target genes at the transcriptional level. ( A , E ) Schematic illustrations of the RAB23 ( A ) and CNOT6 ( E ) genes. The transcription start sites are indicated by arrows, the exons are shown as black boxes, and the polyadenylation signals are indicated by arrowheads. The positions of the PCR primer set for RT-qPCR amplification of the precursor and mature mRNAs are indicated by arrows. ( B – D , F – H ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) using the indicated primer sets. ( I , J ) ChIP analyses of the RAB23 ( I ) and CNOT6 ( J ) gene promoters (position 2 in ) using antibodies against Pol II in HeLa cells treated with control siRNA (siNC) and two distinct PCIF1 targeted siRNAs (siPCIF1 #1 and #3). Normal rabbit IgG was used as the negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1 targeted siRNA (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Amplification, Isolation, Control, Negative Control, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 regulates the stability of target gene mRNAs in opposite ways. After HeLa cells were treated with a negative control siRNA (siNC) and two PCIF1-targeted siRNAs (siPCIF1 #1 and #3) for 72 h, actinomycin D was added to inhibit transcription. Cells were harvested at 0, 2, 4, 8, and 12 h after treatment, and total RNA was isolated. The amount of residual mRNA was analyzed by RT-qPCR at each time point, using the specific primer set detecting PCIF1 ( A ), CRAB23 ( B ), and CNOT6 ( C ) mRNAs. The relative value was calculated using the expression level of β-actin mRNA (ACTB) as a normalizer. The relative values at each time point were calculated relative to time zero. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Negative Control, Isolation, Quantitative RT-PCR, Expressing, Control

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant wild-type but not methyltransferase-deficient mutant PCIF1 restored normal levels of target mRNA expression. ( A ) Immunoblotting analysis of total protein extracts from HeLa cells transfected with a control empty vector (Vec), a vector expressing siRNA-resistant wild-type PCIF1 (siR_wt), or methyltransferase-deficient mutant PCIF1 (siR_mut) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression) with the indicated antibodies. ( B , C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated as in ( A ), using the specific primer set detecting RAB23 ( B ) and CNOT6 ( C ) expression. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Mutagenesis, Western Blot, Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Isolation, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 suppression resulted in a significant decrease in m 6 A levels of both RAB23 and CNOT6 mRNAs. MeRIP-qPCR analysis was performed using HeLa cells treated with control siRNA (siNC) or PCIF1-targeted siRNA (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression). RT-qPCR analysis of RNAs purified from the immunoprecipitates of HeLa cell extracts using the anti-m 6 A antibody, using the specific primer set detecting RAB23 ( A ), CNOT6 ( B ), and ACTB ( C ) mRNAs. The y -axis represents the fold change relative to the RNA levels in the immunoprecipitate by anti-m 6 A antibody from HeLa cells treated with control siRNA (siNC). Normal rabbit IgG (IgG) was used as a negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Control, Quantitative RT-PCR, Purification, Negative Control, Standard Deviation

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: The BBB neocentromere contains a major and a minor centromere chromatin domain. DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-A, CENP-C, and CENP-H from cell line BBB was hybridized to a custom made microarray containing 257 unique polymerase chain reaction (PCR) fragments. Three independent biological replicates were performed for each antibody, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input), were plotted on the y-axis with the standard error (SE) for each PCR fragment. Intensity ratios at least three times the standard deviation (SD) from the background mean (dashed line) were considered positives (see Materials and methods). An alpha satellite containing plasmid was included as a positive control (far right). (a) Centromere protein (CENP)-A ChIP. The major CENP-A domain was about 80.3 kilobases (kb; shaded region), with positive intensity ratios 1.17 to 2.46. The minor domain was about 8.5 kb (shaded region) and was approximately 162 kb downstream from the major domain; intensity ratios were 1.14 to 1.33. Background experimental mean was -0.39 ± 0.47 SD, one-tailed distribution cut-off was ≤ 0.68, positive values were ≥ 1.02 (dashed line). Alpha satellite = 1.63 ± 0.18 SE. (b) CENP-C ChIP. Major CENP-C domain was 87.8 kb (shaded region). Intensity ratios were 0.67 to 3.41. Minor domain was 8.5 kb; intensity ratios were 0.65 to 1.07 (shaded region). Background experimental mean was -0.37 ± 0.34 SD, one-tailed distribution cut-off was ≤ 0.31, positive values were ≥ 0.65 (dashed line). Alpha satellite = 2.36 ± 0.70 SE. (c) CENP-H ChIP. Major CENP-H domain was about 86.3 kb (shaded region), and positive intensity ratios were 0.64 to 3.35. Minor domain was about 1.9 kb (shaded region), and intensity ratios were 0.82 and 1.14. Background experimental mean was -0.33 ± 0.32 SD, one-tailed distribution cutoff was ≤ 0.56, positive values were ≥ 0.63 (dashed lines). Alpha sat = 2.06 ± 0.59 SE. (d) The 2.3 megabase (Mb) region included in the PCR CHIP. The central 350 kb region, covered by PCR fragments at high density. The adjacent megabase on either side of the central region, shown at a 10 fold reduced scale, was covered by PCR fragments at decreasing density. PCR microarray fragments listed in Table 1, found at the edges of CENP-A, CENP-C and CENP-H domains, and the negative values within the first domain, are shown. The major and minor chromatin domains are shown by the rectangles. The tiling path of the unique sequenced regions of each bacterial artificial chromosome (BAC) and their overlaps are shown within the 350 kb region. The corresponding Repeat Masker data from the Human Genome Browser at UCSC and thegenes in the area are indicated [50].

Article Snippet: Each qRT-PRC was performed in a 10 μl volume using equal amounts of input and ChIP DNA (2 to 5 ng), 20 mmol/l Tris HCl (pH 8.4), 5 mmol/l MgCl 2 , 0.2 mmol/l dNTPs, 0.2 μmol/l of each primer, and 0.025U of Platinum Taq DNA polymerase (Invitrogen).

Techniques: Chromatin Immunoprecipitation, Microarray, Polymerase Chain Reaction, Standard Deviation, Plasmid Preparation, Positive Control, One-tailed Test

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: qRT-PCR confirms two separate CenpA domains in the neocentromeric cell line BBB. (a) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on equal amounts of total DNA obtained from centromere protein (CENP)-A chromatin immunoprecipitation (ChIP) DNA and Input DNA from BBB cell line. The thirty-four PCR primer pairs used (shown as black lines in the x-axis) amplified fragments from 150 to 250 base pairs contained within the 350 kb neocentromere region (see Figure 2). Each primer pair was assayed in at least three independent CENP-A ChIP experiments. The qRT-PCR results for each primer pair were expressed on the y-axis as the fold enhancement between the CENP-A ChIP DNA and input DNA (= 1.93 ΔCt(CENP-A-Input) ) normalized to the value obtained for the positive control alpha satellite DNA primer pair (far right). The shaded region indicates the area determined to be the CENP-A domain in Figure 2. (b) The 34 qRT-PCR primer pairs and the 133 PCR products from this region on the PCR microarray (Figure 2) are shown. qRT-PCR primers that amplified products wholly contained within a PCR microarray fragment are indicated by numbers in parentheses; the rest are labeled alphabetically. Only qRT-PCR fragments shown in Table 1 are indicated; information for all other primers can be found in the Additional data file 3. CENP-A domains derived from the PCR microarray data are indicated. Genome coordinates correspond to the region of chr13 from the Human Genome Browser at UCSC (hg17) [50].

Article Snippet: Each qRT-PRC was performed in a 10 μl volume using equal amounts of input and ChIP DNA (2 to 5 ng), 20 mmol/l Tris HCl (pH 8.4), 5 mmol/l MgCl 2 , 0.2 mmol/l dNTPs, 0.2 μmol/l of each primer, and 0.025U of Platinum Taq DNA polymerase (Invitrogen).

Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Amplification, Positive Control, Microarray, Labeling, Derivative Assay

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: CENP-A nucleosomes are interspersed at variable densities throughout the core centromeric domain. (a) The 87.8 kilobase (kb) major domain. Shown are the putative subdomains of centromere protein (CENP)-A, with higher densities indicated by darker shading. The polymerase chain reaction (PCR) microarray fragments are shown below (see Figure 2). The fragments examined using the oligo array are shown in gray. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using CENP-A from cell line BBB was hybridized to a 70 mer oligonucleotide microarray containing two distinct subdomains of the major neocentromere domain, a 1.6 kb region at the 5' end (PCR fragments 3 and 4; Table 1) and a 2 kb region within the domain (PCR fragments 20 and 21). Three independent biological replicates were performed, and the mean log 2 Cy-5:Cy-3 intensity ratio (CENP-A ChIP to input) from each biologic replicate was scale normalized (SN). The result for each 70 mer oligomer is shown plotted on the y-axis with the standard error.

Article Snippet: Each qRT-PRC was performed in a 10 μl volume using equal amounts of input and ChIP DNA (2 to 5 ng), 20 mmol/l Tris HCl (pH 8.4), 5 mmol/l MgCl 2 , 0.2 mmol/l dNTPs, 0.2 μmol/l of each primer, and 0.025U of Platinum Taq DNA polymerase (Invitrogen).

Techniques: Polymerase Chain Reaction, Microarray, Chromatin Immunoprecipitation

Journal: PLoS ONE

Article Title: Expression of MicroRNA-15b and the Glycosyltransferase GCNT3 Correlates with Antitumor Efficacy of Rosemary Diterpenes in Colon and Pancreatic Cancer

doi: 10.1371/journal.pone.0098556

Figure Lengend Snippet: ( A ) Venn diagram representing overlap of the genes significantly modulated (p<0.05 and fold change (FC) >±50%) by RE-2 at 30, 60 and 100 µg/mL after 48 h treatment in SW620 cells according to microarray data. ( B ) Up-regulation of GCNT3 gene expression in SW620 colon cancer cells by five RE's with different composition (RE-1, RE-2, RE-3, RE-4 and RE-5) at the same concentration (90 µg/mL) during 48 h. Bars represent the mean ± SEM of two independent experiments, each performed with biological triplicates and technical duplicates. ANOVA with Bonferroni's post hoc test was applied to test statistically significant differences among RE's. ( C ) Up-regulation of GCNT3 gene expression in SW620 colon cancer cells by 48 h treatment with RE-4 at 60 µg/mL and carnosic acid, carnosol, and the combination of both compounds at the concentrations present in this RE. Bars represent the mean ± SEM of two independent experiments, each performed with biological triplicates and technical duplicates. Student's t test was applied to determine the statistically significant differences between treated and control cells. ( D ) Down-regulation of miR-15b gene expression in SW620 colon cancer cells by 48 h treatment with RE-4 at 60 µg/mL and carnosic acid, carnosol, and the combination of both compounds at the concentrations present in this RE. Student's t test was used to test statistically significant differences between treated and control cells. ( E ) Modulation of miR-15b and miR-939 (as a negative control) in plasma of colon cancer xenograft nude mice after orally intake of RE-5 (1 mg/mL in drinking water), in comparison with the control group of mice. Bars represent mean ± SEM (n = 8). Student's t test was used to assess statistically significant differences between treated and control groups. * p≤0.05, ** p≤0.01, *** p≤0.001. RE: supercritical rosemary extract, Cc+Cl: Carnosic acid and carnosol.

Article Snippet: For gene expression analysis of GCNT3, we used the specific Taqman gene expression assay Hs01921181_s1 (Applied Biosystems). qRT-PCR was performed in the 7900HT Real-Time PCR System (Applied Biosystems), according to the manufacturer's protocol.

Techniques: Microarray, Gene Expression, Concentration Assay, Control, Negative Control, Clinical Proteomics, Comparison

Journal: PLoS ONE

Article Title: Expression of MicroRNA-15b and the Glycosyltransferase GCNT3 Correlates with Antitumor Efficacy of Rosemary Diterpenes in Colon and Pancreatic Cancer

doi: 10.1371/journal.pone.0098556

Figure Lengend Snippet: Modulation of gene and miRNA expression by RE-2 in colon cancer cells.

Article Snippet: For gene expression analysis of GCNT3, we used the specific Taqman gene expression assay Hs01921181_s1 (Applied Biosystems). qRT-PCR was performed in the 7900HT Real-Time PCR System (Applied Biosystems), according to the manufacturer's protocol.

Techniques: Expressing

Journal: Stem Cells Translational Medicine

Article Title: Multiple Autologous Bone Marrow‐Derived CD271 + Mesenchymal Stem Cell Transplantation Overcomes Drug‐Resistant Epilepsy in Children

doi: 10.1002/sctm.17-0041

Figure Lengend Snippet: Molecular and functional analysis of BMMSCs. (A): Percentages of positive cells for subsequent surface markers are given in table. (B): Graphical overview of comparative genomic hybridization microarray results. Expression levels of mRNA for neurotrophic (C) , proangiogenic (D) , and tissue remodeling (E) factors in patients' BMMSCs. qRT‐PCR analysis revealed expression of BDNF, NGF, HGF, PDGF‐A, Flt‐1, VEGF‐A, FGF‐1, FGF‐2, ANGPT‐1, and MMP‐2. Slight expression of GDNF, CNTF, and NGF was observed. No expression of MMP‐9 was detected. The results are mean values ± SD (from triplicates) of mRNA expression relative to expression of housekeeping gene—GAPDH. (F): Western blot detection of VEGF in patients' BMMSCs lysates. Both forms of VEGF were identified: dimer (42 kDa) and monomer (21 kDa). The intermediary band is an effect of nonspecific reaction of antibody, observed also in manufacturer's specification. Standardized protein content in samples from different patients was confirmed by GAPDH detection. (G, H): qRT‐PCR analysis of IDO1 and TSG‐6 mRNA expression levels in patients' BMMSCs stimulated with proinflammatory cytokines. (G): Pretreatment of BMMSCs with INF‐γ caused manifestation of IDO1 expression. (H): Moreover, stimulation of BMMSCs with either TNF‐α or Il‐1β revealed elevated expression of TSG‐6. Pronounced effect was observed for Il‐1β. The results are mean values ± SD (from triplicates) of mRNA expression relative to expression of housekeeping gene—GAPDH. As a control in experiments, BMMSCs in stimulation medium only (2% FBS) were utilized. Abbreviations: ANGPT‐1, angiopoietin 1; BDNF, brain‐derived neurotrophic factor; BMMSC, bone marrow mesenchymal stem cell; CNTF, ciliary neurotrophic factor; FBS, fetal bovine serum; FGF, fibroblast growth factor; Flt‐1, vascular endothelial growth factor receptor 1; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; GDNF, glial‐derived neurotrophic factor; HGF, hepatocyte growth factor; IDO1, indoleamine 2,3‐dioxygenase; Il‐1β, interleukin 1 β; INF‐γ, interferon γ; MMP, metalloproteinase; NGF, nerve growth factor; PDGF, platelet‐derived growth factor; qRT‐PCR, real‐time quantitative reverse transcription polymerase chain reaction; TNF‐α, tumor necrosis factor α; TSG‐6, tumor necrosis factor‐inducible gene 6; VEGF, vascular endothelial growth factor.

Article Snippet: Genes expression were determined by Real‐Time quantitative Reverse Transcription Polymerase Chain Reaction (qRT‐PCR) analysis on ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, https://www.thermofisher.com/us/en/home/brands/applied-biosystems.html ) using Blank qPCR Master Mix (EURx) and the following Taq‐Man probes (Applied Biosystems) for human genes: glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) ‐ Hs02758991_g1, BDNF ‐ Hs02718934_s1, GDNF ‐ Hs01931883_s1, ciliary neurotrophic factor (CNTF) ‐ Hs04194755_s1, nerve growth factor (NGF) ‐ Hs01113193_m1, HGF ‐ Hs00300159_m1, PDGF‐A ‐ Hs00964426_m1, vascular endothelial growth factor receptor 1 (FLT‐1) ‐ Hs01052937_m1, VEGF‐A ‐ Hs00173626_m1‐, heparin‐binding growth factor 1 (FGF‐1) ‐ Hs01092738_m1, FGF‐2 (Hs00266645_m1), angiopoietin 1 (ANGPT‐1) ‐ Hs00375822_m1, metalloproteinase‐2 (MMP‐2) ‐ Hs00234422_m1, metalloproteinase‐9 (MMP‐9) ‐ Hs00234579_m1, indoleamine 2,3‐dioxygenase (IDO1) ‐ Hs00984148_m1, and tumor necrosis factor‐inducible gene 6 (TSG‐6) ‐ Hs01113602_m1. mRNA expression levels were quantified by the 2 −ΔCt calculation using housekeeping GAPDH as a control.

Techniques: Functional Assay, Hybridization, Microarray, Expressing, Quantitative RT-PCR, Western Blot, Control, Derivative Assay, Reverse Transcription, Polymerase Chain Reaction

Journal: Stem Cells Translational Medicine

Article Title: Multiple Autologous Bone Marrow‐Derived CD271 + Mesenchymal Stem Cell Transplantation Overcomes Drug‐Resistant Epilepsy in Children

doi: 10.1002/sctm.17-0041

Figure Lengend Snippet: Molecular and functional analysis of BMMSCs. (A): Percentages of positive cells for subsequent surface markers are given in table. (B): Graphical overview of comparative genomic hybridization microarray results. Expression levels of mRNA for neurotrophic (C) , proangiogenic (D) , and tissue remodeling (E) factors in patients' BMMSCs. qRT‐PCR analysis revealed expression of BDNF, NGF, HGF, PDGF‐A, Flt‐1, VEGF‐A, FGF‐1, FGF‐2, ANGPT‐1, and MMP‐2. Slight expression of GDNF, CNTF, and NGF was observed. No expression of MMP‐9 was detected. The results are mean values ± SD (from triplicates) of mRNA expression relative to expression of housekeeping gene—GAPDH. (F): Western blot detection of VEGF in patients' BMMSCs lysates. Both forms of VEGF were identified: dimer (42 kDa) and monomer (21 kDa). The intermediary band is an effect of nonspecific reaction of antibody, observed also in manufacturer's specification. Standardized protein content in samples from different patients was confirmed by GAPDH detection. (G, H): qRT‐PCR analysis of IDO1 and TSG‐6 mRNA expression levels in patients' BMMSCs stimulated with proinflammatory cytokines. (G): Pretreatment of BMMSCs with INF‐γ caused manifestation of IDO1 expression. (H): Moreover, stimulation of BMMSCs with either TNF‐α or Il‐1β revealed elevated expression of TSG‐6. Pronounced effect was observed for Il‐1β. The results are mean values ± SD (from triplicates) of mRNA expression relative to expression of housekeeping gene—GAPDH. As a control in experiments, BMMSCs in stimulation medium only (2% FBS) were utilized. Abbreviations: ANGPT‐1, angiopoietin 1; BDNF, brain‐derived neurotrophic factor; BMMSC, bone marrow mesenchymal stem cell; CNTF, ciliary neurotrophic factor; FBS, fetal bovine serum; FGF, fibroblast growth factor; Flt‐1, vascular endothelial growth factor receptor 1; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; GDNF, glial‐derived neurotrophic factor; HGF, hepatocyte growth factor; IDO1, indoleamine 2,3‐dioxygenase; Il‐1β, interleukin 1 β; INF‐γ, interferon γ; MMP, metalloproteinase; NGF, nerve growth factor; PDGF, platelet‐derived growth factor; qRT‐PCR, real‐time quantitative reverse transcription polymerase chain reaction; TNF‐α, tumor necrosis factor α; TSG‐6, tumor necrosis factor‐inducible gene 6; VEGF, vascular endothelial growth factor.

Article Snippet: Genes expression were determined by Real‐Time quantitative Reverse Transcription Polymerase Chain Reaction (qRT‐PCR) analysis on ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, https://www.thermofisher.com/us/en/home/brands/applied-biosystems.html ) using Blank qPCR Master Mix (EURx) and the following Taq‐Man probes (Applied Biosystems) for human genes: glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) ‐ Hs02758991_g1, BDNF ‐ Hs02718934_s1, GDNF ‐ Hs01931883_s1, ciliary neurotrophic factor (CNTF) ‐ Hs04194755_s1, nerve growth factor (NGF) ‐ Hs01113193_m1, HGF ‐ Hs00300159_m1, PDGF‐A ‐ Hs00964426_m1, vascular endothelial growth factor receptor 1 (FLT‐1) ‐ Hs01052937_m1, VEGF‐A ‐ Hs00173626_m1‐, heparin‐binding growth factor 1 (FGF‐1) ‐ Hs01092738_m1, FGF‐2 (Hs00266645_m1), angiopoietin 1 (ANGPT‐1) ‐ Hs00375822_m1, metalloproteinase‐2 (MMP‐2) ‐ Hs00234422_m1, metalloproteinase‐9 (MMP‐9) ‐ Hs00234579_m1, indoleamine 2,3‐dioxygenase (IDO1) ‐ Hs00984148_m1, and tumor necrosis factor‐inducible gene 6 (TSG‐6) ‐ Hs01113602_m1. mRNA expression levels were quantified by the 2 −ΔCt calculation using housekeeping GAPDH as a control.

Techniques: Functional Assay, Hybridization, Microarray, Expressing, Quantitative RT-PCR, Western Blot, Control, Derivative Assay, Reverse Transcription, Polymerase Chain Reaction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Gene Expression

Journal: Aging (Albany NY)

Article Title: GRSF1 deficiency in skeletal muscle reduces endurance in aged mice

doi: 10.18632/aging.203151

Figure Lengend Snippet: RT-qPCR validation of microarray results. Levels of Grsf1 mRNA as well as Mgarp , Sln , Cxcl10 , Nfkb2 , and Atf3 mRNAs in muscle from Grsf1cKO and WT mice; n=3 mice for each genotype. The levels of the mRNAs shown were normalized to the levels of Gapdh mRNA in each sample.

Article Snippet: RT was performed by synthesizing cDNAs from the Grsf1cKO and WT control RNAs with the Superscript IV VILO Master Mix (Invitrogen, 11756050) and qPCR amplification was carried out using ready-to-use Taqman probe/primer sets (Applied Biosystems) to detect Grsf1 mRNA (Mm00618578_g1), Mgarp mRNA (Mm00471236_m1), Cxcl10 mRNA (Mm00445235_m1), Nfkb2 mRNA (Mm00479807_m1), Sln mRNA (Mm00481536_m1), Atf3 mRNA (Mm00476033_m1), Il6 mRNA (Mm00446190_m1; Mm00446191_m1), ND6 mRNA [Mm04225325_g1; qMmuCED0041184 (SybrGreen); qMmuCED0061740 (SybrGreen)], Tnf mRNA (Mm00443258_m1; Mm99999068_m1; Mm00443260_g1), p15 mRNA (Mm00483241_m1), p16 mRNA (Mm00494449_m1), and p21 mRNA (Mm04205640_g1).

Techniques: Quantitative RT-PCR, Biomarker Discovery, Microarray

Journal: Cell Host & Microbe

Article Title: A Large Polysaccharide Produced by Helicobacter hepaticus Induces an Anti-inflammatory Gene Signature in Macrophages

doi: 10.1016/j.chom.2017.11.002

Figure Lengend Snippet: Differential Regulation of Transcription by SN Hh t and Pam3 (A–F) Microarray analysis performed on M-CSF BMDMs differentiated from 5 WT mice and stimulated for 3 hr. (A) Principle components analysis (PCA) of transcriptional profiles (empirical Bayes normalized expression values from LIMMA) across three conditions (TSBt, Pam3, and SN Hh t, n = 5/condition, 16,692 probes). (B) Hierarchical clustering heatmap (Manhattan distance with Ward clustering of empirical Bayes normalized expression values) of the union of differentially expressed probes between any condition-condition contrast (i.e., TSBt versus Pam3, TSBt versus SN Hh t, or Pam3 versus SN Hh t) (n = 172 probes, n = 146 genes). Probes were assigned to clusters using k-means clustering (k = 4) and cluster assignments are annotated as colors to the left of the heatmap. The number of probes assigned to each cluster were: cluster 1 = 75, cluster 2 = 10, cluster 3 = 68, and cluster 4 = 19. (C) Scatterplot displaying the relationship between log2 (fold changes) for each gene shown in (B) obtained when comparing either Pam3 (x axis) or SN Hh t (y axis) with the TSBt control condition. Colors represent the cluster assignments. (D and E) Transcription factor (TF) motif enrichment analysis among genes assigned to (D) cluster 4 (i.e., specifically induced by SN Hh t) and (D) cluster 1 (i.e., specifically induced by Pam3). Motif names correspond to Transfac motif identifiers derived from the Molecular Signatures Database (MSigDB). Motifs significantly overrepresented at an adjusted p < 0.05 (permutation test) are shown. (F) mRNA levels of CREB ( Il10 , Fosb , Egr3 , Rcan1 ) and NF-κB ( Il6 , Ccl5 , Cd40 , Icam1 ) target genes were validated by qRT-PCR.

Article Snippet: Cd40 , TaqMan Gene Expression Assays for mouse, Life Technologies , Mm00441891_m1.

Techniques: Microarray, Expressing, Control, Derivative Assay, Quantitative RT-PCR

Journal: Cell Host & Microbe

Article Title: A Large Polysaccharide Produced by Helicobacter hepaticus Induces an Anti-inflammatory Gene Signature in Macrophages

doi: 10.1016/j.chom.2017.11.002

Figure Lengend Snippet: SN Hh t Stimulates CREB Phosphorylation and Induction of an Anti-inflammatory and Repair Gene Signature in Macrophages (A) Western blot showing the phosphorylation of CREB1 S133 and RelA S536 and the total CREB1 and RelA protein amounts in WT and Tlr2 −/− BMDMs after 30 min stimulation with TSBt, SN Hh t, Pam3, or LPS UP. β-actin used as a loading control. (B) mRNA levels of Il10 , Fosb , and Egr3 genes in BMDMs from conditional vav-cre CREB WT and CREB S133A KI mice after 1 hr stimulation with TSBt, Hh , SN Hh t, or Pam3. (C) Induction of IL-10, IL-6, and TNFα; IL-10/IL-6; and IL-10/TNFα protein ratios in BMDMs from conditional vav-cre CREB WT and CREB S133A KI mice after 10 hr stimulation with TSBt, Hh , SN Hh t, or Pam3. One of three independent experiments. Two-way ANOVA and Sidak’s and/or Tukey’s multiple comparisons tests, p < 0.05. (D) mRNA levels of Il10 , Fosb , Egr3 , Rcan1 , Il6 , Tnf , and Cd40 genes in caecum total tissue from WT mice gavaged with TSBt or SN Hh t for 2 days. Each symbol represents an individual mouse (two independent experiments). Mann-Whitney test, p < 0.05. Mean ± SD. See also Figure S5 .

Article Snippet: Cd40 , TaqMan Gene Expression Assays for mouse, Life Technologies , Mm00441891_m1.

Techniques: Phospho-proteomics, Western Blot, Control, MANN-WHITNEY

Journal: Cell Host & Microbe

Article Title: A Large Polysaccharide Produced by Helicobacter hepaticus Induces an Anti-inflammatory Gene Signature in Macrophages

doi: 10.1016/j.chom.2017.11.002

Figure Lengend Snippet:

Article Snippet: Cd40 , TaqMan Gene Expression Assays for mouse, Life Technologies , Mm00441891_m1.

Techniques: Control, Virus, Recombinant, Activation Assay, Enzyme-linked Immunosorbent Assay, Reverse Transcription, Gene Expression, Microarray, Software, Real-time Polymerase Chain Reaction

Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: The Cnot genes maintain self-renewal by repressing early trophectoderm (TE) transcription factors. (A): Cnot1, Cnot2, and Cnot3 knockdown did not immediately affect known self-renewal factors and pathways. Oct4GiP cells were transfected with control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD) in M15 medium. Cells were collected 48 hours after transfection, and total Stat3, Smad1, b-Catenin as well as phospho-Stat3, phospho-Smad1, phosphor-b-Catenin, Oct4, and Nanog levels were determined by Western blot. Starved: control-transfected ESCs cultured in serum-free and LIF-free medium for additional 4 hours. (B): Comparing gene expression changes caused by perturbations of known self-renewal factors: Cnot1, 2, and 3 silencing induced similar changes to those of Oct4 or Sox2 silencing. Pearson's correlation coefficients were calculated between microarray datasets and depicted in a heatmap. The self-renewal factors were clustered by unsupervised hierarchical clustering based on the correlation coefficients. Microarray datasets used for this plot are listed in Supporting Information Table 2. (C): Cnot2 or Cnot3 overexpression cannot rescue Oct4 or Sox2 silencing-induced differentiation. Oct4GiP cells and Oct4GiP cells overexpressing Cnot2 (Cnot2-Rescue, same as in Fig. 1C) or Cnot3 (Cnot3-Rescue, same as in Fig. 1C) were transfected with control, Oct4 (Oct4-KD), or Sox2 (Sox2-KD) siRNAs, and the % differentiation was determined by the Oct4GiP reporter assay. (D): Cnot1, Cnot2, and Cnot3 knockdown induced TE differentiation in the presence of sustained Oct4 expression. ZHBTc4 cells that constitu-tively express Oct4 at the normal level from a Tet-Off promoter were transfected with control or Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), Cnot3-siRNA2 (Cnot3-KD), and the expression of TE markers Cdx2 and Gata3 was determined by qRT-PCR after 4 days. (E): Cdx2 deletion partially rescued Cnot1, Cnot2, and Cnot3 silencing-induced differentiation. Oct4GiP (WT) or dKO23-5 (Cdx2-/- ) cells were transfected with Control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD), and the expression of lineage markers was determined by qRT-PCR 96-hour after transfection. Abbreviations: ESC, embryonic stem cell; KD, Knockdown; WT, wild type.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Transfection, Western Blot, Cell Culture, Expressing, Microarray, Over Expression, Reporter Assay, Quantitative RT-PCR

Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: Silencing Cnot1, Cnot2, or Cnot3 led to mouse embryonic stem cell (ESC) differentiation. (A): Silencing Cnot1, Cnot2, or Cnot3 resulted in ESC differentiation based on the Oct4GiP reporter assay. Oct4GiP ESCs were transfected with indicated siRNAs (two different siR NAs for each CCr4-Not complex gene) in M15 medium and cultured for 4 days. The percentage of differentiated cells (% differentiation) was determined by measuring the percentage of green fluorescent protein-negative cells by fluorescence-activated cell sorting (FACS) at the end of the culture. (B): Expression of siRNA-resistant Cnot2 or Cnot3 rescued the differentiation caused by Cnot2 or Cnot3 knockdown, respectively. Oct4GiP cells or Oct4GiP cells expressing siRNA-resistant Cnot2 (Cnot2-Rescue) or Cnot3 (Cnot3-Rescue) were transfected with Control, Cnot1-siRNA1, Cnot2-siRNA2, or Cnot3-siRNA2, and the percentage of differentiated cells was determined by the Oct4GiP reporter assays. Note that Cnot2-Rescue cells were not able to rescue the differentiation caused by Cnot1 or Cnot3 silencing, and Cnot3-Rescue cells were not able to rescue Cnot1 or Cnot2 silencing. ***, p < .001. (C): Silencing Cnot1, Cnot2, or Cnot3 resulted in morphological changes and loss of alkaline phosphatase (AP) staining in ESCs. Oct4GiP cells were transfected with the indicated siRNAs and cultured in the M15 medium. Cells were stained with the AP staining kit and imaged 4 days after transfection. (D): Cnot1, Cnot2, or Cnot3 silencing led to downregulation of ESC marker and upregulation of differentiation markers. Oct4GiP cells were transfected with the indicated siRNAs and cultured in the M15 medium. Cells were harvested for quantitative real-time PCR (qRT-PCR) analysis 4 days after transfection. ESC marker: Oct4; differentiation markers: Cdx2, Eomes, Gata3, Hand1, and Krt8. (E): Cnot1, Cnot2, or Cnot3 silencing reduced cell proliferation or viability in 2i medium. Oct4GiP cells were transfected with control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD) and cul tured in 2i medium. Cell numbers were counted by FACS 4 days after transfection and normalized to control-transfected cells. (F): Cnot1, Cnot2, or Cnot3 silencing led to differentiation in 2i medium. Oct4GiP cells were transfected with indicated siRNAs and cultured in 2i medium. Cells were harvested for qRT-PCR analysis 4 days after transfection. (G): Expression of C-terminally HA-tagged Cnot2 (Cnot2-HA) in E14Tg2a cells. Expression of the exogenous Cnot2-HA was detected in Western blot with the HA-antibody, and Ran was used as a loading control. Expression of total (endogenous and exogenous) Cnot2 was determined by qPCR in wild-type E14Tg2a (E14) and Cnot2-HA expressing cells. The expression of the Cnot2-HA was estimated to be ∼2-fold of the endogenous Cnot2 on the mRNA level. (H): Identification of Cnot1 and Cnot3 in Cnot2-HA immunoprecipitation. HA-pull-down was carried out in E14Tg2a cells expressing Cnot2-HA. The presence of Cnot1, Cnot2-HA, and Cnot3 in the total lysate and pull-down sample (HA-beads) were detected by Western blot. Note that Oct4 was not detected in the pull down sample. As a negative control, protein-A beads were used in an independent pull-down. Abbreviations: HA, hemagglutinin; IP, immunoprecipitation; KD, knockdown.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Reporter Assay, Transfection, Cell Culture, Fluorescence, FACS, Expressing, Staining, Marker, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Immunoprecipitation, Negative Control

Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: Cnot1, Cnot2, and Cnot3 are required for human embryonic stem cell (ESC) self-renewal. (A): Cnot1, Cnot2, and Cnot3 were down-regulated during human ESC differentiation. H1 human ESCs were differentiated for 7 days using 100 ng/ml human recombinant BMP4. The expression levels of Cnot1, Cnot2, and Cnot3 as well as Oct4 and differentiation markers Cdx2 and Hand1 were determined by quantitative realtime PCR (qRT-PCR). (B): Silencing of Cnot1, Cnot2, or Cnot3 led to morphological changes of human ESCs. H1 cells were imaged 6 days after transfection. Phase-contrast images highlight the undifferentiated morphology of human ESCs in the lipids-only transfected cells (mock) versus the differentiated phenotype in the Cnot1, Cnot2, or Cnot3 siRNA transfected cells. (C): Silencing of the Cnot genes led to upregulation of the Cdx2 and Gata3 proteins. H1 cells were transfected with lipids-only (mock), Oct4, Cnot2, or Cnot3 siRNAs. Cells were fixed and stained for Cdx2 or Gata3 expression by immunofluorescence staining 6 days after transfection. (D): Silencing of the Cnot genes led to downregulation of the ESC marker and upregulation of the extraembryonic markers. H1 cells were harvested 6 days after transfection and marker expression was determined by qRT-PCR. Abbreviations: BMP, bone morphogenetic protein; DAPI, 4′-6-diamidino-2-phenylindole.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Recombinant, Expressing, Quantitative RT-PCR, Transfection, Staining, Immunofluorescence, Marker

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: Elevated NAT10 expression correlates with poor prognosis in HCC patients. (A) Dot blot analyses of total RNA (5 µg) isolated from HCC tissues and adjacent noncancerous liver tissues using an anti‐ac4C antibody, with MB staining as loading control (left panel). Calculation of relative ac4C contents on RNA in HCC tissues and adjacent noncancerous liver tissues (right panel, N = 20). (B) Detection of ac4C levels on mRNA in the same 20 HCC tissues and adjacent noncancerous liver tissues by UPLC‐MS/MS analysis. (C) Large‐scale data mining was used to compare the expression differences in NAT10 mRNA between HCC tissues and adjacent noncancerous liver tissues. (D) Analysis of NAT10 protein levels in HCC and adjacent noncancerous liver tissues ( N = 165) using CPTAC data. (E) NAT10 protein levels in HCC tissues and adjacent noncancerous liver tissues measured by western blotting ( N = 8). (F) Representative IHC images of NAT10 expression in the Tongji cohort tissue microarray (TMA) including HCC tissues and adjacent noncancerous liver tissues (left panel); pie chart showing percentages of cases with differential NAT10 expression profiles compared to adjacent noncancerous liver tissues ( N = 103, right panel, scale bar: 200 µm or 20 µm). (G) Kaplan‐Meier plot correlating NAT10 expression with patient overall and recurrence‐free survival using CPTAC, TCGA, and Tongji datasets. (H) Analysis of NAT10 expression correlation with malignant features of HCC using Tongji TMA cohort and TCGA LIHC datasets. Statistical tests: (A, B, D) paired t test; (G) log‐rank test; (H) Pearson chi‐squared test (2‐sided). Abbreviations: ANL, adjacent noncancerous liver tissue; HCC, hepatocellular carcinoma; IHC, immunohistochemistry; LIHC, Liver hepatocellular carcinoma; TCGA, The Cancer Genome Atlas; CPTAC, Clinical Proteomic Tumor Analysis Consortium; MB, methylene blue; ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; mRNA, messenger RNA.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Expressing, Dot Blot, Isolation, Staining, Control, Tandem Mass Spectroscopy, Western Blot, Microarray, Immunohistochemistry

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: NAT10 knockdown inhibits HCC progression in vitro and in vivo. (A) Western blot analysis of NAT10 expression post NAT10 knockdown (upper panel). Dot blot analysis of ac4C levels in total RNA and mRNA isolated from control or NAT10‐knockdown HCC cells (lower panel, MHCC‐97H and SNU449), with MB staining as loading control. (B) and (C) CCK8 assay for cell viability of NAT10‐knockdown and control cells at indicated time points. (D) Colony formation assay quantification for indicated cells. (E) Soft agar colony formation assay quantification for indicated cells. (F) Scratch wound healing assays quantification for indicated cells. (G) Cell migration and invasion assays quantification for MHCC‐97H and SNU449 cells. (H) Subcutaneous xenograft models with NAT10‐knockdown and control cells ( n = 5, scale bar: 1 cm). Tumor volume monitored and growth curves generated over 24 days (left panel); tumors weighed (right panel). (I) and (J) Representative images and quantitative data analysis of Ki67‐positive (I) and TUNEL‐positive (J) cells, (scale bar: 20 µm). (K) Representative bioluminescence imaging of liver orthotopic implantation models (left panel) and quantification of intrahepatic metastatic nodules (right panel) ( n = 5). (L) Representative bioluminescence imaging of lung metastasis models (left panel) and quantification of lung metastatic nodules (right panel) ( n = 5). (B‐G) Data shown as mean ± SD, n = 3. Statistical analysis: Unpaired t tests. ** P < 0.01, *** P < 0.001. Abbreviations: MB, methylene blue; ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; GAPDH, Glyceraldehyde‐3‐phosphate dehydrogenase; TUNEL, terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick‐end labeling; CCK‐8, Cell Counting Kit‐8; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Knockdown, In Vitro, In Vivo, Western Blot, Expressing, Dot Blot, Isolation, Control, Staining, CCK-8 Assay, Colony Assay, Soft Agar Assay, Migration, Generated, TUNEL Assay, Imaging, End Labeling, Cell Counting, Standard Deviation

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: Effects of nat10 on ac4c mRNA modification and global mRNA translation. (A) Flow chart depicting acRIP‐seq. (B) Number of ac4C peaks identified in acRIP‐seq in shCtrl and shNAT10 MHCC‐97H cells. (C) Number of ac4C‐modified genes identified in acRIP‐seq. Common ac4C genes have ≥ 1 common ac4C peak, while unique ac4C genes have no common ac4C peaks. (D) Top consensus motif identified by HOMER with acRIP‐seq peaks in MHCC‐97H cells with or without NAT10 knockdown. (E) Normalized distribution of ac4C peaks on mRNA in shCtrl and shNAT10 MHCC‐97H cells. (F) Heatmaps of 125 transcripts displaying reduced ac4C peaks in shNAT10 cells. (G) Flow chart depicting RNA‐seq and Ribo‐seq. (H) Heatmaps of transcript level (RNA‐seq) and RPF abundance (Ribo‐seq). (I) Cumulative distribution of log2‐fold changes of mRNA‐normalized ribosome footprint reads (T.E) for ac4C(−) and ac4C(+) transcripts in shCtrl and shNAT10 MHCC‐97H cells (Kolmogorov‐Smirnov test or two‐tailed t‐test). (J) Polysome profiling of shCtrl and shNAT10 MHCC‐97H cells. (K) Western blot images of SUnSET assays quantifying nascent (puromycin‐labeled) peptides in shCtrl and shNAT10 MHCC‐97H cells. GAPDH used as loading control. Abbreviations: acRIP‐seq, acetylated RNA immunoprecipitation and sequencing; RNA‐seq, RNA sequencing; Ribo‐seq, ribosome profiling analyses; T.E, translation efficiency; ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; GAPDH, Glyceraldehyde‐3‐phosphate dehydrogenase; RPF, ribosome protected fragment; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Modification, Knockdown, RNA Sequencing, Two Tailed Test, Western Blot, Labeling, Control, RNA Immunoprecipitation, Sequencing, Standard Deviation

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: ac4C modification enhances translation of HMGB2. (A) Schematic diagram of the strategy for pinpointing key NAT10 targets in HCC. (B) Fold changes of transcript level (RNA‐seq) and RPF abundance (Ribo‐seq) of 4 downstream targets. (C) Heatmap of RPF abundance for downstream 4 target genes and rank in ordered NAT10 targets gene list using RPF and T.E fold changes. (D) ac4C (top) and RPF (bottom) abundances on HMGB2 mRNA transcripts in shCtrl and shNAT10 MHCC‐97H cells. (E) acRIP‐qPCR analysis for indicated cells. (F) Western blot of HMGB2 protein expression in NAT10‐deficient cells. (G) HCC cells were treated with 10 µmol/L MG132 for 12 hours. (H) NAT10‐deficient or control cells transfected with pmirGLO‐HMGB2 reporter for 24 h, and HMGB2 translation efficiency defined as reporter protein production (F‐luc/R‐luc) divided by mRNA abundance . (I) Relative mRNA distribution of HMGB2 in ribosome fractions analyzed by qRT‐PCR in shCtrl and shNAT10 MHCC‐97H cells. (J) Subcutaneous xenograft model transplanted with indicated cells ( n = 6, scale bar: 1 cm). Tumor volume monitored and growth curves generated over 24 days (left panel); tumors weighed (right panel). (K) Liver orthotopic implantation models transplanted with indicated cells (scale bar: 1,000 µm). Representative bioluminescence imaging of mice (left panel) and quantification of tumor nodules (right panel) ( n = 5). (L) Lung metastasis model transplanted with indicated cells (scale bar: 1,000 µm). Representative bioluminescence imaging of mice (left panel) and quantification of lung metastatic nodules (right panel) ( n = 5). (M) Representative images of NAT10 and HMGB2 protein expression in HCC tissue arrays ( N = 103) by IHC (upper panel). Pearson correlation analysis between NAT10 and HMGB2 protein expression (lower panel). (N) Pearson correlation analysis between NAT10 and HMGB2 protein expression using CPTAC LIHC dataset. (E) and (H) Data are shown as mean ± SD, n = 3. Statistical analysis: Unpaired t‐tests. * P < 0.05, ** P < 0.01, *** P < 0.001. Abbreviations: ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; GAPDH, Glyceraldehyde‐3‐phosphate dehydrogenase; CPTAC, Clinical Proteomic Tumor Analysis Consortium; qRT‐PCR, quantitative real‐time polymerase chain reaction; RNA‐seq, RNA sequencing; Ribo‐seq, ribosome profiling analyses; T.E, translation efficiency; acRIP, acetylated RNA immunoprecipitation; HMGB2, High Mobility Group Protein B2; IHC, immunohistochemistry; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Modification, RNA Sequencing, Western Blot, Expressing, Control, Transfection, Quantitative RT-PCR, Generated, Imaging, Real-time Polymerase Chain Reaction, RNA Immunoprecipitation, Immunohistochemistry, Standard Deviation

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: CDS ac4C sites of HMGB2 mRNA enhance binding of eEF2. (A) Schematic of RNA affinity chromatography and MS analysis. (B) Dot blot showing ac4C levels (left) and MB (right, loading controls) in ac4C/C ssRNA probes. (C) GO biological process analysis of proteins identified in quantitative MS via the Database for Annotation, Visualization, and Integrated Discovery. (D) Venn diagram comparing proteins identified in ss‐ac4C and acFUS. (E) Volcano plot of identified proteins. Proteins significantly enriched in ss‐ac4C RNA are shown as red dots. Log2 fold change plotted on x‐axis; ‐log10 P value on y‐axis. (F) Western blot images of endogenous eEF2 and SRP68 proteins pulled down by biotin‐labeled C‐Oligos and ac4C‐Oligos from MHCC‐97H whole cell lysates. (G) RNA pull‐down assays showing dose‐dependent interaction between endogenous eEF2 and biotin‐labeled C‐Oligos (top) or ac4C‐Oligos (below). Gray signal of bands in Western blots (left) quantified by Image Master Total Lab (right). (H) RIP‐qPCR analysis of enrichment of HMGB2 mRNA on eEF2 relative to IgG in shCtrl and shNAT10 MHCC‐97H cells. (I) Western blot analysis of HMGB2 expressions in Huh7 cells co‐transfected with NAT10 CDS plasmid or eEF2 siRNA. (J) Schematic representation of acRIP‐qPCR with fragmented RNA from cells (left). ac4C in HMGB2 mRNA analyzed by acRIP‐qPCR using fragmented RNA in MHCC‐97H cells with shCtrl and shNAT10 (right). (K) Western blot analysis on HA‐HMGB2 in MHCC‐97H cells seeded in 6‐well plates and transfected with either wild‐type HMGB2 CDS or mutant1/2/3 HMGB2 CDS plasmid, along with control or NAT10‐deficient cells. (L) NAT10‐deficient or control cells transfected with either wild‐type HMGB2 CDS or mutant1/2/3 HMGB2 CDS reporter for 24 h, and the quotient of reporter protein production defines translation efficiency of HMGB2. (M) Binding of eEF2 with CDS or 5′ UTR in control or NAT10‐deficient cells analyzed by eEF2 RIP‐qPCR using fragmented RNA. (N) Western blotting showing endogenous eEF2 proteins pulled down by biotin‐labeled exon‐C RNA and exon‐ac4C RNA from MHCC‐97H whole cell lysates. (H, J, L‐N) Data are shown as mean ± SD, n = 3. Statistical analysis: Unpaired t‐tests. * P < 0.05, ** P < 0.01, *** P < 0.001. Abbreviations: MS, mass spectrometry; ac4C, N4‐acetylcytidine; MB, methylene blue; GO, Gene ontology analysis; RIP, RNA immunoprecipitates; NAT10, N‐acetyltransferase 10; HMGB2, High Mobility Group Protein B2; eEF2, eukaryotic Elongation Factor 2; CDS, coding sequence; UTR, untranslated regions; acRIP, acetylated RNA immunoprecipitation; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Binding Assay, Affinity Chromatography, Dot Blot, Western Blot, Labeling, Transfection, Plasmid Preparation, Control, Mass Spectrometry, Sequencing, RNA Immunoprecipitation, Standard Deviation

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: Characterization of the NAT10 inhibitor panobinostat. (A) Western blot and dot blot were used to detect HMGB2 expression and ac4C levels after transfection of NAT10 (WT) or G641E NAT10 mutant plasmid, respectively. (B) Flow diagram of NAT10 inhibitor screening. (C) Three‐dimensional (3D) binding model of Panobinostat in NAT10 catalytic pocket. (D) Biacore analysis revealing binding between NAT10 protein and Panobinostat. (E) Western blots for effects of Panobinostat on thermal stabilization of NAT10 protein. CETSA assayed in cell lysates. (F) Identification of direct binding between Panobinostat and NAT10 via DARTS assays. (G) Effects of various concentrations of Panobinostat on global ac4C modification in MHCC‐97H cells. Dot blot assays were conducted with total RNA. (H) Effects of various concentrations of Panobinostat on poly(A)+ RNA ac4C modification in MHCC‐97H cells. (I) Effects of Panobinostat on levels of nascent (puromycin‐labeled) peptides and expression of HMGB2. (J) Effects of Panobinostat on HMGB2 mRNA ac4C level using acRIP‐qPCR. (K) Effects of Panobinostat on HMGB2 mRNA translation efficiency. (L) RIP‐qPCR analysis was performed to determine the enrichment of HMGB2 mRNA on eEF2 relative to IgG in both control and Panobinostat‐treated cells. (J‐L) Data is shown as mean ± SD, n = 3. Statistical analysis: Unpaired t‐tests. ** P < 0.01, *** P < 0.001. Abbreviations: WT, wild type; ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; HMGB2, High Mobility Group Protein B2; eEF2, eukaryotic Elongation Factor 2; RIP, RNA immunoprecipitates; DARTS, drug affinity responsive targets stability assay; CETSA, cellular thermal shift assay; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: Western Blot, Dot Blot, Expressing, Transfection, Mutagenesis, Plasmid Preparation, Binding Assay, Modification, Labeling, Control, Stability Assay, Thermal Shift Assay, Standard Deviation

Journal: Cancer Communications

Article Title: Targeting N4‐acetylcytidine suppresses hepatocellular carcinoma progression by repressing eEF2‐mediated HMGB2 mRNA translation

doi: 10.1002/cac2.12595

Figure Lengend Snippet: Panobinostat exhibits promising anti‐HCC efficacy in vitro and in vivo. (A) IC50 values of Panobinostat in MHCC‐97H after 48 h of treatment. (B) Effects of various concentrations of Panobinostat on colony formation abilities of MHCC‐97H cells. (C) Effects of various concentrations of Panobinostat on cell migration and invasion abilities of MHCC‐97H cells (scale bars = 100 µm). (D) Schematic diagram of generation and treatment of HCC models in mice. (E) Effects of different concentrations of Panobinostat on tumor volume and weight of subcutaneous xenograft model ( n = 8, scale bar: 1 cm). (F) Effects of various concentrations of Panobinostat on ac4C level in subcutaneous xenograft model. (G) Effects of various concentrations of Panobinostat on HMGB2 expression level in subcutaneous xenograft model. (H) Representative IHC images of HMGB2 expression in subcutaneous xenograft model (scale bar: 20 µm). (I) Liver orthotopic implantation models transplanted with indicated cells (scale bar: 1000 µm). Representative bioluminescence imaging of mice (left panel) and quantification of tumor nodules (right panel) (0 mg, n = 8; 5‐10 mg, n = 10). (J) Lung metastasis model transplanted with indicated cells (scale bar: 1000 µm). Representative bioluminescence imaging of mice (left panel) and quantification of lung metastatic nodules (right panel) ( n = 9). (K) Graphic illustration depicts how NAT10 modulates ac4C‐mediated translation elongation to promote HCC progression. (A‐C) Data is shown as mean ± SD, n = 3. Statistical analysis: Unpaired t‐tests. ** P < 0.01, *** P < 0.001. Abbreviations: IC50, a half‐maximal inhibitory concentration; ac4C, N4‐acetylcytidine; NAT10, N‐acetyltransferase 10; HMGB2, High Mobility Group Protein B2; IHC, immunohistochemistry; SD, standard deviation.

Article Snippet: NAT10 protein (Origene, Rockville, MD, USA) was immobilized onto a CM7 chip (GE Healthcare Life Sciences, Marlborough, MA, USA) via amine coupling.

Techniques: In Vitro, In Vivo, Migration, Expressing, Imaging, Concentration Assay, Immunohistochemistry, Standard Deviation